Review



p stat2 y690  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Cell Signaling Technology Inc p stat2 y690
    P Stat2 Y690, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p+y690+stat2/pmc13045241-48-33-48
    Average 86 stars, based on 1 article reviews
    p stat2 y690 - by Bioz Stars, 2026-09
    86/100 stars

    Images

    Related Articles

    other:

    Article Title: STAT3 is activated in multicellular spheroids of colon carcinoma cells and mediates expression of IRF9 and interferon stimulated genes
    Article Snippet: The following antibodies were from Cell Signaling Technology: IRF9 (#76684), STAT1 (#9172), P-Y701-STAT1 (#9171), STAT2 (#72604), P-Y690-STAT2 (#88410), STAT3 (#4904), P-Y705-STAT3 (#9145).

    Sequencing:

    Article Title: STAT2 hinders STING intracellular trafficking and reshapes its activation in response to DNA damage
    Article Snippet: .. p-T404 STAT2 (Rabbit host) Wang et al, 2020 N/A p-Y245 STING (Rabbit host) Affinity Biosciences Cat:#CF2P HSV1 ICP0 (Mouse host) Abcam Cat: ab6513 Calreticulin(Rabbit host) Cell Signaling technology Cat:#12238 p-S366 hSTING (Rabbit host) Cell Signaling technology Cat:#19781 STAT2(Rabbit host) Cell Signaling technology Cat: #72604 p-S396 IRF3 (Rabbit host) Cell Signaling technology Cat:#29047 p-S172 IKKε (Rabbit host) Cell Signaling technology Cat:#8766 p-Y690 STAT2 (Rabbit host) Cell Signaling technology Cat:#88410 β-Tubulin (Rabbit host) Cell Signaling technology Cat:#2146 GAPDH (Rabbit host) Cell Signaling technology Cat:#5174 Actin (Rabbit host) Cell Signaling technology Cat:#3700 IRF3 (Rabbit host) Abcam Cat:ab68481 HA antibody(Mouse host) Abcam Cat:ab18181 STING antibody (Rabbit host) Abclonal technology Cat:A3575 Calnexin Antibody(Rabbit host) Gensript Cat: A01240 CD63(Mouse host) MBL International Corporation Cat:D263-3 IRF3 (Alexa Fluor® 488) Abcam Cat:ab204647 Human STING/TMEM173 Antibody R&D system AF6516 Oligonucleotides and sequence-based reagents h-18S rRNA-F, CTACCACATCCAAGGAAGCA This study Material and Method section h-18S rRNAR,TTTTTCGTCACTACCTCCCCG This study Material and Method section h-IFNβ-F, CAACTTGCTTGGATTCCTACAAAG This study Material and Method section h-IFNβ-R , TATTCAAGCCTCCCATTCAATTG This study Material and Method section h-IFNα-F, AATGACAGAATTCATGAAAGCGT This study Material and Method section h-IFNα-R, GGAGGTTGTCAGAGCAGA This study Material and Method section h-Ccl20-F, AAGTTGTCTGTGTGCGCAAATCC This study Material and Method section h-Ccl20-R, CCATTCCAGAAAAGCCACAGTTTT This study Material and Method section h-Ifit2F,TGCACTGCAACCATGAGTGAGAACA This study Material and Method section h-Ifit2R,GCCAGTAGGTTGCACATTGTGGC This study Material and Method section h-GAPDH-F, TCCCTGAGCTGAACGGGAAG This study Material and Method section h-GAPDH-R, GGAGGAGTGGGTGTCGCTGT This study Material and Method section h-IL6-F, AGACAGCCACTCACCTCTTCAG This study Material and Method section h-IL6-R, TTCTGCCAGTGCCTCTTTGCTG This study Material and Method section h-CXCL10-F, GGTGAGAAGAGATGTCTGAATCC This study Material and Method section h-CXCL10-R, GTCCATCCTTGGAAGCACTGCA This study Material and Method section HSV-ICP0-F, GTCGCCTTACGTGAACAAGAC This study Material and Method section HSV-ICP0-R, GTCGCCATGTTTCCCGTCTG This study Material and Method section Si-mSTAT2 Santa Cruz Biotechnology sc-37272-PR SgSTING sequence :GCTGGGACTGCTGTTAAACG This study Material and Method section Chemicals, enzymes and other reagents 2'3'-cGAMP InvivoGen Cat:tlrl-nacga23-02 Cisplatin Selleckchem Cat:NSC 119875 Polyethyleneimine(PEI) Mpbio Cat:195444 Lipofectamine 2000 Invitrogen Cat:11668019 GFP trap Chromotek Cat: gta-10 IFN-β PBL Interferon Source Cat:11415-1 .. & Frise, E. et al. (2012), GraphPad Prism version 8.3 for Windows, GraphPad Software www.graphpad.com



    Similar Products

    p stat2 y690  (Cell Signaling Technology Inc)
    86
    Cell Signaling Technology Inc p stat2 y690
    P Stat2 Y690, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p+y690+stat2/pmc13045241-48-33-48
    Average 86 stars, based on 1 article reviews
    p stat2 y690 - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    rabbit anti p stat2 y690 mab  (Cell Signaling Technology Inc)
    96
    Cell Signaling Technology Inc rabbit anti p stat2 y690 mab
    Rabbit Anti P Stat2 Y690 Mab, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p+y690+stat2/Phospho-Stat2+(Tyr690)+Rabbit+mAb/pmc12266391-221-16-29
    Average 96 stars, based on 1 article reviews
    rabbit anti p stat2 y690 mab - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    d3b7 rabbit mab cell signaling technology 8826s p stat2 y690  (Cell Signaling Technology Inc)
    95
    Cell Signaling Technology Inc d3b7 rabbit mab cell signaling technology 8826s p stat2 y690
    D3b7 Rabbit Mab Cell Signaling Technology 8826s P Stat2 Y690, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p+y690+stat2/Phospho-Stat1+(Ser727)+Rabbit+mAb/pmc11046697__pnas__2402226121__sapp-203-23-26
    Average 95 stars, based on 1 article reviews
    d3b7 rabbit mab cell signaling technology 8826s p stat2 y690 - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    anti p stat2 y690  (Cell Signaling Technology Inc)
    96
    Cell Signaling Technology Inc anti p stat2 y690
    Anti P Stat2 Y690, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p+y690+stat2/Phospho-Stat2+(Tyr690)+Rabbit+mAb/med_rxiv__2024__06__14__24308555-326-101-103
    Average 96 stars, based on 1 article reviews
    anti p stat2 y690 - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    anti p‐stat2 (y690) (#d3p2p, rrid: ab_2773718)  (Cell Signaling Technology Inc)
    90
    Cell Signaling Technology Inc anti p‐stat2 (y690) (#d3p2p, rrid: ab_2773718)
    A549 ACE2/TMPRSS2 cells deficient for RIG‐I and MDA5 were reconstituted to express only MDA5 or RIG‐I by lentiviral transduction. Cells were mock‐infected or infected with SARS‐CoV‐2 (upper panel: MOI 0.01, lower panel: MOI 1) for 24 h. IFN‐β ( IFNB1 ) expression was determined by qRT‐PCR (bar graph), and MDA5, RIG‐I, and <t>STAT2</t> protein levels as well as STAT2 phosphorylation (pSTAT2) were analyzed by immunoblotting (lower panel). qPCR values were normalized to 45S rRNA and expressed as mean ± SD, n ≥ 4 (biological replicates, individual experiments shown as dots). Statistical significance between mock and infected samples was tested by a paired two‐tailed t ‐test. * P < 0.05, ** P < 0.01, no asterisk: not significant. Immunoblot representative of two biological replicates. Nasal swabs were taken from healthy individuals of the indicated age groups ( n = 18 children, n = 23 adults) and analyzed by scRNA‐Seq (Loske et al , ). MDA5 ( IFIH1 ) and RIG‐I ( RIGI ) gene expression were quantified across all epithelial cell types of children and adults and displayed as violin plots (median indicated). Statistical significance between all conditions was tested using a two‐tailed Wilcoxon comparison adjusted with a Bonferroni correction. *** P < 0.001, no asterisk: not significant. Source data are available online for this figure.
    Anti P‐Stat2 (Y690) (#D3p2p, Rrid: Ab 2773718), supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p+y690+stat2/anti+stat2/pmc10702842-332-26-34
    Average 90 stars, based on 1 article reviews
    anti p‐stat2 (y690) (#d3p2p, rrid: ab_2773718) - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    p y690 stat2  (Cell Signaling Technology Inc)
    96
    Cell Signaling Technology Inc p y690 stat2
    A549 ACE2/TMPRSS2 cells deficient for RIG‐I and MDA5 were reconstituted to express only MDA5 or RIG‐I by lentiviral transduction. Cells were mock‐infected or infected with SARS‐CoV‐2 (upper panel: MOI 0.01, lower panel: MOI 1) for 24 h. IFN‐β ( IFNB1 ) expression was determined by qRT‐PCR (bar graph), and MDA5, RIG‐I, and <t>STAT2</t> protein levels as well as STAT2 phosphorylation (pSTAT2) were analyzed by immunoblotting (lower panel). qPCR values were normalized to 45S rRNA and expressed as mean ± SD, n ≥ 4 (biological replicates, individual experiments shown as dots). Statistical significance between mock and infected samples was tested by a paired two‐tailed t ‐test. * P < 0.05, ** P < 0.01, no asterisk: not significant. Immunoblot representative of two biological replicates. Nasal swabs were taken from healthy individuals of the indicated age groups ( n = 18 children, n = 23 adults) and analyzed by scRNA‐Seq (Loske et al , ). MDA5 ( IFIH1 ) and RIG‐I ( RIGI ) gene expression were quantified across all epithelial cell types of children and adults and displayed as violin plots (median indicated). Statistical significance between all conditions was tested using a two‐tailed Wilcoxon comparison adjusted with a Bonferroni correction. *** P < 0.001, no asterisk: not significant. Source data are available online for this figure.
    P Y690 Stat2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/p+y690+stat2/Phospho-Stat2+(Tyr690)+Rabbit+mAb/pmc10120020__pnas__2216953120__sapp-62-60-64
    Average 96 stars, based on 1 article reviews
    p y690 stat2 - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    A549 ACE2/TMPRSS2 cells deficient for RIG‐I and MDA5 were reconstituted to express only MDA5 or RIG‐I by lentiviral transduction. Cells were mock‐infected or infected with SARS‐CoV‐2 (upper panel: MOI 0.01, lower panel: MOI 1) for 24 h. IFN‐β ( IFNB1 ) expression was determined by qRT‐PCR (bar graph), and MDA5, RIG‐I, and STAT2 protein levels as well as STAT2 phosphorylation (pSTAT2) were analyzed by immunoblotting (lower panel). qPCR values were normalized to 45S rRNA and expressed as mean ± SD, n ≥ 4 (biological replicates, individual experiments shown as dots). Statistical significance between mock and infected samples was tested by a paired two‐tailed t ‐test. * P < 0.05, ** P < 0.01, no asterisk: not significant. Immunoblot representative of two biological replicates. Nasal swabs were taken from healthy individuals of the indicated age groups ( n = 18 children, n = 23 adults) and analyzed by scRNA‐Seq (Loske et al , ). MDA5 ( IFIH1 ) and RIG‐I ( RIGI ) gene expression were quantified across all epithelial cell types of children and adults and displayed as violin plots (median indicated). Statistical significance between all conditions was tested using a two‐tailed Wilcoxon comparison adjusted with a Bonferroni correction. *** P < 0.001, no asterisk: not significant. Source data are available online for this figure.

    Journal: EMBO Reports

    Article Title: Immune–epithelial cell cross‐talk enhances antiviral responsiveness to SARS‐CoV ‐2 in children

    doi: 10.15252/embr.202357912

    Figure Lengend Snippet: A549 ACE2/TMPRSS2 cells deficient for RIG‐I and MDA5 were reconstituted to express only MDA5 or RIG‐I by lentiviral transduction. Cells were mock‐infected or infected with SARS‐CoV‐2 (upper panel: MOI 0.01, lower panel: MOI 1) for 24 h. IFN‐β ( IFNB1 ) expression was determined by qRT‐PCR (bar graph), and MDA5, RIG‐I, and STAT2 protein levels as well as STAT2 phosphorylation (pSTAT2) were analyzed by immunoblotting (lower panel). qPCR values were normalized to 45S rRNA and expressed as mean ± SD, n ≥ 4 (biological replicates, individual experiments shown as dots). Statistical significance between mock and infected samples was tested by a paired two‐tailed t ‐test. * P < 0.05, ** P < 0.01, no asterisk: not significant. Immunoblot representative of two biological replicates. Nasal swabs were taken from healthy individuals of the indicated age groups ( n = 18 children, n = 23 adults) and analyzed by scRNA‐Seq (Loske et al , ). MDA5 ( IFIH1 ) and RIG‐I ( RIGI ) gene expression were quantified across all epithelial cell types of children and adults and displayed as violin plots (median indicated). Statistical significance between all conditions was tested using a two‐tailed Wilcoxon comparison adjusted with a Bonferroni correction. *** P < 0.001, no asterisk: not significant. Source data are available online for this figure.

    Article Snippet: The following commercially available antibodies were used: rabbit monoclonal antibodies anti‐p‐IRF3 (S396) (#4947S, RRID: AB_823547), anti p‐STAT1 (Y701) (#7649S, RRID: AB_10950970), anti‐STAT2 (#72604S, RRID: AB_2799824), anti p‐STAT2 (Y690) (#D3P2P, RRID: AB_2773718) were purchased from Cell Signaling Technology.

    Techniques: Transduction, Infection, Expressing, Quantitative RT-PCR, Western Blot, Two Tailed Test, Comparison